ID: 1167512587_1167512592

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1167512587 1167512592
Species Human (GRCh38) Human (GRCh38)
Location 19:49903607-49903629 19:49903651-49903673
Sequence CCCTGACATTTTTGGGGTTTACT TGCTGAAGCTGAGTCATACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!