ID: 1167517051_1167517054

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1167517051 1167517054
Species Human (GRCh38) Human (GRCh38)
Location 19:49929538-49929560 19:49929552-49929574
Sequence CCGAAGGCGCGCGGCTGCGCATG CTGCGCATGCGCACTGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25} {0: 1, 1: 0, 2: 5, 3: 19, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!