ID: 1167525176_1167525179

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1167525176 1167525179
Species Human (GRCh38) Human (GRCh38)
Location 19:49979113-49979135 19:49979157-49979179
Sequence CCAATGGGGTCATATGGAGACAC TTCTAGGTTGTTCCTCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104} {0: 1, 1: 0, 2: 2, 3: 18, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!