ID: 1167534474_1167534486

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1167534474 1167534486
Species Human (GRCh38) Human (GRCh38)
Location 19:50041027-50041049 19:50041078-50041100
Sequence CCAGCACACTTTTATTATGTTAC ATGTGGCTGGGCTGGAGGCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 49, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!