ID: 1167565013_1167565026

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1167565013 1167565026
Species Human (GRCh38) Human (GRCh38)
Location 19:50250635-50250657 19:50250683-50250705
Sequence CCGAGGCACCTGCGGGATCAGGC GGCAAGGTAGGGGCTGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116} {0: 1, 1: 0, 2: 12, 3: 185, 4: 1261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!