ID: 1167569221_1167569225

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1167569221 1167569225
Species Human (GRCh38) Human (GRCh38)
Location 19:50276535-50276557 19:50276549-50276571
Sequence CCTGAGGAAGGGCCTTTTGGAAA TTTTGGAAAAGGGTTTTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211} {0: 1, 1: 0, 2: 5, 3: 54, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!