ID: 1167574212_1167574226

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1167574212 1167574226
Species Human (GRCh38) Human (GRCh38)
Location 19:50309928-50309950 19:50309967-50309989
Sequence CCCCCACCTGGGTCCCCTGCAAC ACCCCTAAACACAGAGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 359} {0: 1, 1: 0, 2: 2, 3: 16, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!