ID: 1167580125_1167580135

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1167580125 1167580135
Species Human (GRCh38) Human (GRCh38)
Location 19:50336545-50336567 19:50336577-50336599
Sequence CCCTGCTCCACCAGTACATCCAG AACTCCTTCCACAGACAGAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!