ID: 1167580125_1167580139

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1167580125 1167580139
Species Human (GRCh38) Human (GRCh38)
Location 19:50336545-50336567 19:50336588-50336610
Sequence CCCTGCTCCACCAGTACATCCAG CAGACAGAATGGGAAAACCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 168} {0: 2, 1: 0, 2: 0, 3: 15, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!