ID: 1167585953_1167585956

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1167585953 1167585956
Species Human (GRCh38) Human (GRCh38)
Location 19:50376020-50376042 19:50376053-50376075
Sequence CCCAGGACGCAGAGGCTGGAGTG ACACCACTGCACTCCAGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 2642, 3: 40000, 4: 128500} {0: 892, 1: 25374, 2: 107217, 3: 199260, 4: 215289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!