ID: 1167585954_1167585955

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1167585954 1167585955
Species Human (GRCh38) Human (GRCh38)
Location 19:50376021-50376043 19:50376052-50376074
Sequence CCAGGACGCAGAGGCTGGAGTGA CACACCACTGCACTCCAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 23, 2: 4170, 3: 62700, 4: 125109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!