ID: 1167588324_1167588327

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1167588324 1167588327
Species Human (GRCh38) Human (GRCh38)
Location 19:50387711-50387733 19:50387732-50387754
Sequence CCCGGGTCTCTCCTCGCAGATCA CATCACTCCCTGTCCCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132} {0: 1, 1: 0, 2: 1, 3: 23, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!