ID: 1167588865_1167588871

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1167588865 1167588871
Species Human (GRCh38) Human (GRCh38)
Location 19:50391654-50391676 19:50391669-50391691
Sequence CCAGCCTCAGCTCGGCATCAGAG CATCAGAGGGAGACTGAGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 51, 4: 555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!