ID: 1167595876_1167595885

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1167595876 1167595885
Species Human (GRCh38) Human (GRCh38)
Location 19:50427909-50427931 19:50427931-50427953
Sequence CCACTTCCCTCACCCCACTTTTC CAGATCCAGGAGATGGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 96, 4: 1010} {0: 1, 1: 0, 2: 5, 3: 43, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!