ID: 1167646533_1167646536

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1167646533 1167646536
Species Human (GRCh38) Human (GRCh38)
Location 19:50708763-50708785 19:50708802-50708824
Sequence CCCATCATTCATTCACTCATTTT CACTCAACAAAGATGGAACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 42, 3: 300, 4: 1654} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!