ID: 1167667795_1167667802

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1167667795 1167667802
Species Human (GRCh38) Human (GRCh38)
Location 19:50832821-50832843 19:50832845-50832867
Sequence CCCTCAGTGGTGTCTGCCTCCCC ACGAGACTGGCAGCTCCCCGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!