|
Left Crispr |
Right Crispr |
| Crispr ID |
1167668997 |
1167669005 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:50838997-50839019
|
19:50839025-50839047
|
| Sequence |
CCTGGGTCTGAGGGAGGAGGGGC |
GCCCGCACTCCTGGGTCTGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 488, 1: 393, 2: 276, 3: 259, 4: 884} |
{0: 1, 1: 10, 2: 337, 3: 496, 4: 479} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|