ID: 1167691130_1167691136

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1167691130 1167691136
Species Human (GRCh38) Human (GRCh38)
Location 19:50984069-50984091 19:50984088-50984110
Sequence CCACTGCACTCTCTCTCCACCCT CCCTCCCTCCGAAGGACGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 147, 4: 1212} {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!