ID: 1167694097_1167694102

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1167694097 1167694102
Species Human (GRCh38) Human (GRCh38)
Location 19:51003776-51003798 19:51003826-51003848
Sequence CCAGTGACAGAGTTTGTTCTCCA TGACTGGAAACAGCGCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 156} {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!