ID: 1167694105_1167694115

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1167694105 1167694115
Species Human (GRCh38) Human (GRCh38)
Location 19:51003880-51003902 19:51003919-51003941
Sequence CCAACACACTCAGCACCCCACTG CAGCTTTTCCAAAGGACCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 301} {0: 1, 1: 0, 2: 0, 3: 22, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!