ID: 1167696625_1167696638

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1167696625 1167696638
Species Human (GRCh38) Human (GRCh38)
Location 19:51019079-51019101 19:51019125-51019147
Sequence CCAGAGCCCGGGCGCCAGAGGCG TCTCATGGCCAGGATCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 353} {0: 1, 1: 0, 2: 2, 3: 22, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!