ID: 1167698610_1167698628

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1167698610 1167698628
Species Human (GRCh38) Human (GRCh38)
Location 19:51029391-51029413 19:51029443-51029465
Sequence CCACAGACCCCCAGGACACCAGA GCCCCCAGAATCACCCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 420} {0: 1, 1: 0, 2: 5, 3: 13, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!