ID: 1167703662_1167703674

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1167703662 1167703674
Species Human (GRCh38) Human (GRCh38)
Location 19:51065761-51065783 19:51065793-51065815
Sequence CCCCTCTCCACCCCCAGTGGCTC TCTCCAGGCACCCCCGACCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!