ID: 1167721965_1167721975

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1167721965 1167721975
Species Human (GRCh38) Human (GRCh38)
Location 19:51185485-51185507 19:51185515-51185537
Sequence CCGGCCGCCCGGGAAACCTGACC TGTCCTGGGCCTGTGAGCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 8, 3: 30, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!