ID: 1167752470_1167752478

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1167752470 1167752478
Species Human (GRCh38) Human (GRCh38)
Location 19:51389131-51389153 19:51389148-51389170
Sequence CCCCGCCCGGCCCCTCTCTGGCT CTGGCTGCTCAGCTCTCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 20, 3: 179, 4: 1172} {0: 1, 1: 0, 2: 1, 3: 44, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!