ID: 1167772704_1167772717

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1167772704 1167772717
Species Human (GRCh38) Human (GRCh38)
Location 19:51530926-51530948 19:51530971-51530993
Sequence CCTGGGATGGAGATGTTGGGCCT ATGGGGACGCAGGATCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 160} {0: 1, 1: 1, 2: 1, 3: 26, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!