ID: 1167773295_1167773299

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1167773295 1167773299
Species Human (GRCh38) Human (GRCh38)
Location 19:51537191-51537213 19:51537214-51537236
Sequence CCTTATAAAGGAGCCTATCAGGG CCCTTGAGAATACGATCAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 1, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!