ID: 1167781101_1167781109

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1167781101 1167781109
Species Human (GRCh38) Human (GRCh38)
Location 19:51599460-51599482 19:51599504-51599526
Sequence CCAATTCTGGACACATTGGTACA TACCTTGTAGGAGCTAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 89, 4: 360} {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!