ID: 1167785156_1167785172

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1167785156 1167785172
Species Human (GRCh38) Human (GRCh38)
Location 19:51630067-51630089 19:51630114-51630136
Sequence CCCGGAACCAGTAGACGTAGAGT CAGGGGTAAGAGAAGGAGCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 49} {0: 2, 1: 0, 2: 11, 3: 91, 4: 816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!