ID: 1167793291_1167793298

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1167793291 1167793298
Species Human (GRCh38) Human (GRCh38)
Location 19:51693505-51693527 19:51693523-51693545
Sequence CCCTGGCCTTGAGACCCACACGA CACGATGGCCCTGCTGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 108} {0: 1, 1: 0, 2: 0, 3: 26, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!