ID: 1167793296_1167793305

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1167793296 1167793305
Species Human (GRCh38) Human (GRCh38)
Location 19:51693519-51693541 19:51693556-51693578
Sequence CCCACACGATGGCCCTGCTGGCT CCCGTCTGCCCTGCTGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159} {0: 1, 1: 0, 2: 11, 3: 267, 4: 661}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!