ID: 1167793300_1167793310

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1167793300 1167793310
Species Human (GRCh38) Human (GRCh38)
Location 19:51693532-51693554 19:51693568-51693590
Sequence CCTGCTGGCTCTGGCCAGTGCCG GCTGGCCCTGGCTGTCTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 289} {0: 1, 1: 0, 2: 4, 3: 29, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!