ID: 1167793301_1167793314

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1167793301 1167793314
Species Human (GRCh38) Human (GRCh38)
Location 19:51693546-51693568 19:51693580-51693602
Sequence CCAGTGCCGTCCCGTCTGCCCTG TGTCTTCAGGGTGCCCGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 175} {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!