ID: 1167793304_1167793314

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1167793304 1167793314
Species Human (GRCh38) Human (GRCh38)
Location 19:51693556-51693578 19:51693580-51693602
Sequence CCCGTCTGCCCTGCTGGCCCTGG TGTCTTCAGGGTGCCCGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 37, 3: 271, 4: 856} {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!