ID: 1167804004_1167804006

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1167804004 1167804006
Species Human (GRCh38) Human (GRCh38)
Location 19:51766581-51766603 19:51766594-51766616
Sequence CCTAGTAATCTTGGGGGAATCCC GGGGAATCCCTTTCAAAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!