ID: 1167843402_1167843417

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1167843402 1167843417
Species Human (GRCh38) Human (GRCh38)
Location 19:52140065-52140087 19:52140106-52140128
Sequence CCGGGCCGGAGCGGCAGTGGGCG CGGAGCCGCGGCGGAGGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 224} {0: 1, 1: 0, 2: 3, 3: 20, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!