ID: 1167855720_1167855726

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1167855720 1167855726
Species Human (GRCh38) Human (GRCh38)
Location 19:52238032-52238054 19:52238063-52238085
Sequence CCTCCTGAAGTGCTCAGATTACA CCACTTTGCTCAGCCAAAAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 53, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!