ID: 1167904622_1167904625

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1167904622 1167904625
Species Human (GRCh38) Human (GRCh38)
Location 19:52648801-52648823 19:52648833-52648855
Sequence CCTGCTCTAGTCACTACGGAGTC TATGCACAGCTGAAGCTTGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!