ID: 1167915291_1167915297

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1167915291 1167915297
Species Human (GRCh38) Human (GRCh38)
Location 19:52735175-52735197 19:52735216-52735238
Sequence CCGGGGCGGGATCTGCGCGTCTC TCTCTGTTTTCAGGTTTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 57} {0: 1, 1: 1, 2: 4, 3: 83, 4: 871}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!