|
Left Crispr |
Right Crispr |
| Crispr ID |
1167930248 |
1167930259 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:52857722-52857744
|
19:52857739-52857761
|
| Sequence |
CCTTGCCCTTTAGAACCCGCAGA |
CGCAGAGGGCGGGGCCGGAGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 4, 2: 3, 3: 11, 4: 173} |
{0: 2, 1: 1, 2: 13, 3: 74, 4: 533} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|