ID: 1167945680_1167945685

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1167945680 1167945685
Species Human (GRCh38) Human (GRCh38)
Location 19:52986701-52986723 19:52986732-52986754
Sequence CCTTGCTCCATCTTTGCATTCAA GGCTCACGACTCCTACTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 385} {0: 1, 1: 1, 2: 0, 3: 4, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!