ID: 1167983983_1167983991

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1167983983 1167983991
Species Human (GRCh38) Human (GRCh38)
Location 19:53299682-53299704 19:53299708-53299730
Sequence CCAGGACCCAGGGCAAGCGCCTG GGCAGGCTGGAGAGCACCATGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 26, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!