ID: 1168052139_1168052145 |
View in Genome Browser |
Spacer: 14 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1168052139 | 1168052145 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 19:53837295-53837317 | 19:53837332-53837354 |
| Sequence | CCATGTTGCTCATACAAAGCCTG | CACACGGACGCGCATGAAATGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 9, 2: 14, 3: 22, 4: 45} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||