ID: 1168052142_1168052145

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1168052142 1168052145
Species Human (GRCh38) Human (GRCh38)
Location 19:53837314-53837336 19:53837332-53837354
Sequence CCTGTTTGGTGGTCTCTTCACAC CACACGGACGCGCATGAAATGGG
Strand - +
Off-target summary {0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130} {0: 1, 1: 9, 2: 14, 3: 22, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!