ID: 1168054207_1168054210

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1168054207 1168054210
Species Human (GRCh38) Human (GRCh38)
Location 19:53852568-53852590 19:53852619-53852641
Sequence CCAGCCTTCTTCTTCTTCTTCTT GGAGTCTCTACCTGTCACCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!