ID: 1168063289_1168063296

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1168063289 1168063296
Species Human (GRCh38) Human (GRCh38)
Location 19:53906157-53906179 19:53906176-53906198
Sequence CCTCCATTTGCCTGTTTCCCCTG CCTGGCTGTTCTTATCTCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 319} {0: 1, 1: 0, 2: 0, 3: 25, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!