ID: 1168076404_1168076418

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1168076404 1168076418
Species Human (GRCh38) Human (GRCh38)
Location 19:53982776-53982798 19:53982828-53982850
Sequence CCCCCGGGACCCTGGCCAAGGAG CAGGAAAACCACGCCTGTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 190} {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!