ID: 1168081299_1168081312

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1168081299 1168081312
Species Human (GRCh38) Human (GRCh38)
Location 19:54012342-54012364 19:54012385-54012407
Sequence CCTTTCTCCCTCTGTAAATACGT GGGTTGCTTGGGGGTGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165} {0: 1, 1: 1, 2: 8, 3: 72, 4: 583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!