ID: 1168095157_1168095172

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1168095157 1168095172
Species Human (GRCh38) Human (GRCh38)
Location 19:54110245-54110267 19:54110289-54110311
Sequence CCTTCCACCTTCCCATCCCTCCG AGTCCTGAGTGCCCTCCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 245, 4: 2264} {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!