ID: 1168095160_1168095173

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1168095160 1168095173
Species Human (GRCh38) Human (GRCh38)
Location 19:54110252-54110274 19:54110290-54110312
Sequence CCTTCCCATCCCTCCGGCTCCCC GTCCTGAGTGCCCTCCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 109, 4: 1492} {0: 1, 1: 0, 2: 0, 3: 19, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!